We are actively tracking the number of publications by the scientific community which reference our structures, whether in the main text, figure captions or supplementary material. Selected articles are manually reviewed. Publications by SSGCID authors are excluded from the manually reviewed list. From our manual curation results, we estimate that the false positive rate might be as high as 50% for some structures.
This list was obtained from Google Scholar searches using an API provided by Christian Kreibich.
| Structure | Year released | #citations |
|---|---|---|
| 7TY0 | 2022 | 0 |
| 7TXZ | 2022 | 0 |
| # | PDB | Additional SSGCID structures cited | Link | Title | Year | Citation | Highlighted abstract |
|---|---|---|---|---|---|---|---|
| 1 | 6nb7 | 6nb6 | https://arxiv.org/abs/2101.01884 | Exploring the Regulatory Function of the N-terminal Domain of SARS-CoV-2 Spike Protein Through Molecular Dynamics Simulation | 2021 | Y Li, T Wang, J Zhang, B Shao, H Gong- arXiv preprint arXiv, 2021 - arxiv.org | taking the S proteins of SARS-CoV with 2 upward RBDs ( PDB ID: 6NB6) (21) and 3 upward RBDs ( PDB ID: 6NB7 ) (21) as We also conducted a time- structure based Independent Components Analysis (tICA) (34, 35) to identify slow motions with high time autocorrelation on |
| 2 | 3ijp | - | https://www.sciencedirect.com/science/article/pii/S0304416520302610 | Comparative structural and mechanistic studies of 4-hydroxy-tetrahydrodipicolinate reductases from Mycobacterium tuberculosis and Vibrio vulnificus | 2021 | S Pote, S Kachhap, NJ Mank, L Daneshian- et Biophysica Acta (BBA, 2021 - Elsevier | This paper focuses on structural and mechanistic studies of DapB The structure for DapB has been determined from various bacterial species including Escherichia coli [14], Bartonella henselae [15 Fig. 2. (A) Tetrameric assembly of DapB from V. vulnificus ( PDB ID: 5TEN) |
| 3 | 6wpt | - | https://hal.archives-ouvertes.fr/hal-03257466/document | Hyaluronic Acid-2-Deoxy-D-Glucose Conjugate Act as a Promising Targeted Drug Delivery Option for the Treatment of COVID-19 | 2021 | R Thirumalaisamy, V Aroulmoji- International, 2021 - hal.archives-ouvertes.fr | of 2DG and HA-2DG was submitted to Online SMILES convertor and Structure file generator proteases Mpro (6LU7), papain like protease PLpro (6W9C), spike protein ( 6WPT ), RNA dependent RNA polymerase (6M71) was retrieved from RCSB PDB database (https |
| 4 | 2lwk | - | https://onlinelibrary.wiley.com/doi/abs/10.1002/advs.202004379 | Light-Driven Cascade Mitochondria-to-Nucleus Photosensitization in Cancer Cell Ablation | 2021 | KN Wang, LY Liu, G Qi, XJ Chao, W Ma, Z Yu- Advanced, 2021 - Wiley Online Library | Herein, a light-driven, mitochondria-to-nucleus cascade dual organelle cancer cell ablation strategy is reported. structure of BT-Ir and DNA structure (5-CAATCGGATCGAATTCGATCCGATTG- 3, PDB code: 5ju4) and RNA structure (5- GAGUAGAAACAAGGCUUCGG CCUGCUUUUGCU-3, PDB code: 2lwk ) using AutoDock 4.2 |
| 5 | 6ws6 | - | https://sciendo.com/pdf/10.2478/rrlm-2021-0022 | Insights into Innate Immune Response Against SARS-CoV-2 Infection | 2021 | A Huanu, AM Georgescu, AV Andrejkovits- Revista Romn de, 2021 - sciendo.com | The NET structure made by activated neutrophils and mediated by reactive oxygen species bacterial lipopolysaccharides (LPS), flagella, cilia, bacterial unmethylated DNA, or viral structures like dsARN or In addition, sev- eral structural and non- structural SARS-CoV-2 proteins |
| 6 | 6x79 | - | https://www.biorxiv.org/content/10.1101/2021.05.06.441046v1.abstract | Structure-based design of a highly stable, covalently-linked SARS-CoV-2 spike trimer with improved structural properties and immunogenicity | 2021 | E Olmedillas, CJ Mann, W Peng, YT Wang, RD Avalos- bioRxiv, 2021 - biorxiv.org | For VFLIP_D614G, a population of 213,852 particles yielded a 2.8 resolution structure (Figure S2). Importantly, the density maps confirm Further sub-classification revealed an overall architecture that is similar to other closed spikes in the Protein Data Bank ( PDB ). ... A previously published structure of the SARS-CoV-2 ectodomain with all RBDs in the down conformation (PDB ID 6X79) was used to fit the cryo-EM maps in UCSF ChimeraX |
| 7 | 6wpt | - | https://advances.sciencemag.org/content/7/16/eabf3671?utm_campaign=TrendMD_1&utm... | The SARS-CoV-2 spike variant D614G favors an open conformational state | 2021 | RA Mansbach, S Chakraborty, K Nguyen- Science, 2021 - advances.sciencemag.org | 1 Structural representation of the Spike protein. (A) The Spike complex is shown in the all-down conformation. Its S1 and S2 subunits are depicted in red and blue We display the domains highlighted in the Spike structure , shown from two different perspectives ... S309 Fab binding to up-RBD was modeled by rigid-body alignment to closed-RBD and Fab interactions from PDB structure 6WPT (21), using the backbone of residues 331 to 527 for least squares fitting. |
| 8 | 6wps | - | https://academic.oup.com/glycob/advance-article-abstract/doi/10.1093/glycob/cwab... | Modernized uniform representation of carbohydrate molecules in the Protein Data Bank | 2021 | C Shao, Z Feng, JD Westbrook, E Peisach- , 2021 - academic.oup.com | glycan structures (eg, SARS-CoV-2 protein-carbohydrate complex PDB ID 6WPS ) and the partnership is committed to maintaining consistency and accuracy across the PDB archive by regularly reviewing data processing procedures and carrying out structure remediation efforts |
| 9 | 6cum | - | https://onlinelibrary.wiley.com/doi/abs/10.1107/S2059798321004368 | Introduction to molecular replacement: a time perspective | 2021 | E Dodson- Acta Crystallographica Section D: Structural, 2021 - Wiley Online Library | the phase error between the correct value and the phases generated from the best solution; Dphi_DM, the phase error after density modification, which was performed with Parrot, except for PDB entry 6cum , which used Rebuilt?, Yes if the test structure could be rebuilt |
| 10 | 6q04 | - | https://link.springer.com/article/10.1007/s00705-021-04961-y | A comparative study of human betacoronavirus spike proteins: structure, function and therapeutics | 2021 | J Verma, N Subbarao- Archives of virology, 2021 - Springer | Coronaviruses are the paradigm of emerging 21st century zoonotic viruses, triggering numerous outbreaks and a severe global health crisis. The current COVI. |