We are actively tracking the number of publications by the scientific community which reference our structures, whether in the main text, figure captions or supplementary material. Selected articles are manually reviewed. Publications by SSGCID authors are excluded from the manually reviewed list. From our manual curation results, we estimate that the false positive rate might be as high as 50% for some structures.
This list was obtained from Google Scholar searches using an API provided by Christian Kreibich.
| Structure | Year released | #citations |
|---|---|---|
| 7TY0 | 2022 | 0 |
| 7TXZ | 2022 | 0 |
| # | PDB | Additional SSGCID structures cited | Link | Title | Year | Citation | Highlighted abstract |
|---|---|---|---|---|---|---|---|
| 1 | 6cw5 | - | https://ubipayroll.com/earthline/index.php/ejcs/article/view/282 | In silico Structural Modelling of Ribokinase from Salmonella Typhi | 2021 | H Abubakar, Y Ndatsu, AD Musa, C Ogbiko- Earthline Journal of, 2021 - ubipayroll.com | done to check the stereochemical features of the predicted 3-dimensional structure of the BLASTp showed low identity of 40% (Table 1) with other proteins deposited in PDB and conserved domain (Figure 1). Multiple sequence alignment between the query, 6CW5 , 2FV7, 1VM7 |
| 2 | 6wpt | - | https://www.ncbi.nlm.nih.gov/pmc/articles/pmc8144490/ | Synthesis and cytotoxic activity of novel Indole derivatives and their in silico screening on spike glycoprotein of SARS-CoV-2 | 2021 | P Gobinath, DA Ponnusamy Packialakshmi- Frontiers in molecular, 2021 - ncbi.nlm.nih.gov | molecular protein crystal structure of spike glycoprotein of SARS-CoV-2 PDB ID 6WPT The ligand preparation module optimized the ligand 3D structure of selected molecules to remove molecular interaction analysis with selected small molecules of (1c) with 6WPT protein was |
| 3 | 2lwk | - | https://onlinelibrary.wiley.com/doi/abs/10.1002/advs.202004379 | Light-Driven Cascade Mitochondria-to-Nucleus Photosensitization in Cancer Cell Ablation | 2021 | KN Wang, LY Liu, G Qi, XJ Chao, W Ma, Z Yu- Advanced, 2021 - Wiley Online Library | Herein, a light-driven, mitochondria-to-nucleus cascade dual organelle cancer cell ablation strategy is reported. structure of BT-Ir and DNA structure (5-CAATCGGATCGAATTCGATCCGATTG- 3, PDB code: 5ju4) and RNA structure (5- GAGUAGAAACAAGGCUUCGG CCUGCUUUUGCU-3, PDB code: 2lwk ) using AutoDock 4.2 |
| 4 | 4wgj | 4lu4, 4py3, 4xi8 | https://royalsocietypublishing.org/doi/abs/10.1098/rsob.210009 | Fic and non-Fic AMPylases: protein AMPylation in metazoans | 2021 | BK Chatterjee, MC Truttmann- Open Biology, 2021 - royalsocietypublishing.org | name, organism name, references, function/targets, structure ( PDB ID) BepC, Bartonella henselae, [59], triggers actin stress fibre formation in HeLa cells, 4WGJ salt bridges occur between (a) Asp117 and Lys119 of the extended flap region (a -hairpin like structure that partially |
| 5 | 7jv2 | 7jx3 | https://pubs.acs.org/doi/abs/10.1021/acscentsci.1c00216 | Molecular Aspects Concerning the Use of the SARS-CoV-2 Receptor Binding Domain as a Target for Preventive Vaccines | 2021 | Y Valdes-Balbin, D Santana-Mederos- ACS Central, 2021 - ACS Publications | The development of recombinant COVID-19 vaccines has resulted from scientific progress made at an unprecedented speed during 2020. The recombinant spike glycoprotein monomer, its trimer, and its re... Structural analyses were performed from PDB: 6M0J for the complex ACE2–RBD, (9) PDB: 7BZ5 for B38, (85) PDB: 7BYR for BD23, (86) PDB: 6XEY for Fab2-4, (87) PDB: 7BWJ for P2B-2F6, (88) PDB: 7JV2 for S2H13 |
| 6 | 6ws6 | - | https://sciendo.com/pdf/10.2478/rrlm-2021-0022 | Insights into Innate Immune Response Against SARS-CoV-2 Infection | 2021 | A Huanu, AM Georgescu, AV Andrejkovits- Revista Romn de, 2021 - sciendo.com | The NET structure made by activated neutrophils and mediated by reactive oxygen species bacterial lipopolysaccharides (LPS), flagella, cilia, bacterial unmethylated DNA, or viral structures like dsARN or In addition, sev- eral structural and non- structural SARS-CoV-2 proteins |
| 7 | 6x79 | - | https://www.biorxiv.org/content/10.1101/2021.05.06.441046v1.abstract | Structure-based design of a highly stable, covalently-linked SARS-CoV-2 spike trimer with improved structural properties and immunogenicity | 2021 | E Olmedillas, CJ Mann, W Peng, YT Wang, RD Avalos- bioRxiv, 2021 - biorxiv.org | For VFLIP_D614G, a population of 213,852 particles yielded a 2.8 resolution structure (Figure S2). Importantly, the density maps confirm Further sub-classification revealed an overall architecture that is similar to other closed spikes in the Protein Data Bank ( PDB ). ... A previously published structure of the SARS-CoV-2 ectodomain with all RBDs in the down conformation (PDB ID 6X79) was used to fit the cryo-EM maps in UCSF ChimeraX |
| 8 | 6wpt | - | https://advances.sciencemag.org/content/7/16/eabf3671?utm_campaign=TrendMD_1&utm... | The SARS-CoV-2 spike variant D614G favors an open conformational state | 2021 | RA Mansbach, S Chakraborty, K Nguyen- Science, 2021 - advances.sciencemag.org | 1 Structural representation of the Spike protein. (A) The Spike complex is shown in the all-down conformation. Its S1 and S2 subunits are depicted in red and blue We display the domains highlighted in the Spike structure , shown from two different perspectives ... S309 Fab binding to up-RBD was modeled by rigid-body alignment to closed-RBD and Fab interactions from PDB structure 6WPT (21), using the backbone of residues 331 to 527 for least squares fitting. |
| 9 | 6brl | - | https://onlinelibrary.wiley.com/doi/abs/10.1002/jimd.12387 | Metabolic impact of pathogenic variants in the mitochondrial glutamyltRNA synthetase EARS2 | 2021 | M Ni, LF Black, C Pan, H Vu, J Pei, B Ko- Journal of Inherited, 2021 - Wiley Online Library | 3A and B). Structural modeling of human EARS2 was obtained from the SWISS-MODEL Page 10. repository (Bienert et al 2017) based on the crystal structure of the glutamyl-tRNA synthetase from Elizabethkingia meningosepticum ( PDB : 6brl ), and superimposed on the crystal |
| 10 | 6wps | - | https://academic.oup.com/glycob/advance-article-abstract/doi/10.1093/glycob/cwab... | Modernized uniform representation of carbohydrate molecules in the Protein Data Bank | 2021 | C Shao, Z Feng, JD Westbrook, E Peisach- , 2021 - academic.oup.com | glycan structures (eg, SARS-CoV-2 protein-carbohydrate complex PDB ID 6WPS ) and the partnership is committed to maintaining consistency and accuracy across the PDB archive by regularly reviewing data processing procedures and carrying out structure remediation efforts |