SSGCID
Seattle Structural Genomics Center for Infectious Disease

Cited Structures: list of articles citing SSGCID structures

We are actively tracking the number of publications by the scientific community which reference our structures, whether in the main text, figure captions or supplementary material. Selected articles are manually reviewed. Publications by SSGCID authors are excluded from the manually reviewed list. From our manual curation results, we estimate that the false positive rate might be as high as 50% for some structures.

This list was obtained from Google Scholar searches using an API provided by Christian Kreibich.

Cited structures

Manually reviewed citations

# PDB Additional SSGCID structures cited Link Title Year Citation Highlighted abstract
1 2lwk - http://pubs.acs.org/doi/abs/10.1021/acs.jcim.5b00593 Can Holo NMR Chemical Shifts be Directly Used to Resolve RNA-Ligand Poses? 2016 AT Frank - Journal of Chemical Information and Modeling, 2016 - ACS Publications ... shift data within standard procedures to aid in efficiently determining the 3D structure ofRNA-ligand complexes by acting as an additional source of structural information that is 4 Page4 of 30 ... promoter-DPQ complex (PDBID: 2LWK, BMRBID: 18633)37 (see Fig. 1). ...
2 2lwk - https://www.sciencedirect.com/science/article/pii/S0168945218302693 RNA on the move: the plasmodesmata perspective 2018 BC Reagan, EE Ganusov, JC Fernandez, TN McCray- Plant Science, 2018 - Elsevier While this synthetic RNA consists of only 32 nucleotides, it has a corresponding radius of gyration of 15.48 Å (1.548 nm) when bound to the small molecule DPQ (6,7-dimethoxy-2-(piperazin-1-yl)quinazolin-4-amine) (PDB ID: 2LWK)
3 2lwk - http://pubs.acs.org/doi/abs/10.1021/jp407254m Prediction of RNA 1H and 13C chemical shifts: a structure based approach 2013 AT Frank, SH Bae, AC Stelzer - The Journal of Physical Chemistry …, 2013 - ACS Publications ... which 1 H and 13 C chemical shifts data were acquired, and a structural description. ... each chemicalshift entry was mapped to local 3D descriptors calculated from PDB coordinates. ... 1 H chemicalshifts for the nuclei corresponding to those in our chemical shift-structure database. ...
4 2lwk - https://www.biorxiv.org/content/biorxiv/early/2021/01/10/2021.01.10.426061/DC1/e... Supporting Information for Occurrences of protonated base triples in RNA are determined by their cooperative binding energies and specific functional 2021 A Halder, A Jhunjhunwala, D Bhattacharyya, A Mitra - biorxiv.org Figure S1: Context of occurrences of G(CC) H:+ Trans/W:W Cis triple (System 2). 2D representation of (A) the 5S rRNA, (B) Domain III of 25S rRNA of S. cerevisiae and (C) HDV ribozyme are shown and the structural motifs that contain (G) 3D structure of the PDB : 3KIR Chain: A
5 2lwk - https://link.springer.com/chapter/10.1007/7355_2016_20 Viral RNA targets and their small molecule ligands 2017 T Hermann- RNA Therapeutics, 2017 - Springer disrupt or stabilize the RNA hairpin and thereby affect the equilibrium between translation of structural and enzymatically The three-dimensional structure of the FFS RNA in complex with a synthetic compound has been The added tetraloop is indicated in grey ( PDB : 2LWK ) [34]
6 2lwk - https://onlinelibrary.wiley.com/doi/abs/10.1002/advs.202004379 Light-Driven Cascade Mitochondria-to-Nucleus Photosensitization in Cancer Cell Ablation 2021 KN Wang, LY Liu, G Qi, XJ Chao, W Ma, Z Yu- Advanced, 2021 - Wiley Online Library Herein, a light-driven, mitochondria-to-nucleus cascade dual organelle cancer cell ablation strategy is reported. structure of BT-Ir and DNA structure (5-CAATCGGATCGAATTCGATCCGATTG- 3, PDB code: 5ju4) and RNA structure (5- GAGUAGAAACAAGGCUUCGG CCUGCUUUUGCU-3, PDB code: 2lwk ) using AutoDock 4.2
7 2lwk - http://www.sciencedirect.com/science/article/pii/S0006349515011601 Predicting 3D Structure, Flexibility, and Stability of RNA Hairpins in Monovalent and Divalent Ion Solutions 2015 YZ Shi, L Jin, FH Wang, XL Zhu, ZJ Tan - Biophysical journal, 2015 - Elsevier TABLE 1 The 32 RNA Molecules for 3D Structure Prediction in This Work 26 2LWK ...
8 2lwk - http://www.mdpi.com/1422-0067/17/6/779/htm Recent Advances in Developing Small Molecules Targeting Nucleic Acid 2016 M Wang, Y Yu, C Liang, A Lu, G Zhang - International journal of molecular , 2016 - mdpi.com ... Figure 12A) consists of a planar ring, an amino sugar structure and a fused cyclohexane ringsystem. A lot of structural studies have been investigated to understand the interaction betweenDNA duplex and molecule [28,46,47,48,49,50,51]. Most of the structures indicate that ...
9 2lwk - https://portal.ichb.pl/wp-content/uploads/2023/02/Doktorat_AleksandraJarmoowicz.... Small molecules interacting with Influenza virus RNA and SARS-CoV-2 RNA as potential inhibitors of replication 2022 A Jarmoowicz - portal.ichb.pl M121 structural motif of segment 5 (+)RNA secondary structure was investigated by importance of the conserved secondary structure of mentioned structural motif and suggest that it
10 2lwk - http://onlinelibrary.wiley.com/doi/10.1002/wrna.1373/full Small molecules targeting viral RNA 2016 T Hermann - Wiley Interdisciplinary Reviews: RNA, 2016 - Wiley Online Library ... The added tetraloop is indicated in gray. (c) Detail view of the ligand binding site in theNMR model, showing hydrogen atoms of the ligand 11. Structure images were preparedfrom PDB coordinate file 2LWK.[48]. Download figure to PowerPoint. ...