We are actively tracking the number of publications by the scientific community which reference our structures, whether in the main text, figure captions or supplementary material. Selected articles are manually reviewed. Publications by SSGCID authors are excluded from the manually reviewed list. From our manual curation results, we estimate that the false positive rate might be as high as 50% for some structures.
This list was obtained from Google Scholar searches using an API provided by Christian Kreibich.
| Structure | Year released | #citations |
|---|---|---|
| 5SD7 | 2022 | 0 |
| 5SD2 | 2022 | 0 |
| 4POB | 2014 | 0 |
| 5SCZ | 2022 | 0 |
| 8DGD | 2023 | 0 |
| 8DIM | 2022 | 0 |
| 5SCV | 2022 | 0 |
| 3L0D | 2009 | 0 |
| 5SCW | 2022 | 0 |
| 4W9U | 2014 | 0 |
| # | PDB | Additional SSGCID structures cited | Link | Title | Year | Citation | Highlighted abstract |
|---|---|---|---|---|---|---|---|
| 1 | 3q8n | - | http://www.sciencedirect.com/science/article/pii/S0734975014001992 | Bioinformatic analysis of a PLP-dependent enzyme superfamily suitable for biocatalytic applications | 2015 | F Steffen-Munsberg, C Vickers, H Kohls, H Land… - Biotechnology …, 2015 - Elsevier | In this review we analyse structure/sequence-function relationships for the superfamily ofPLP-dependent enzymes with special emphasis on class III transaminase. |
| 2 | 4tv4 | - | https://www.sciencedirect.com/science/article/pii/S0092867419302028 | Cryo-EM Structure and Assembly of an Extracellular Contractile Injection System | 2019 | F Jiang, N Li, X Wang, J Cheng, Y Huang, Y Yang- Cell, 2019 - Elsevier | Overall, the PVC particle displays a simplified structure of the bacterial phage A simplified architecture of T4 phage baseplate lies in the PVC syringe: Pvc5, Pvc7, Pvc8, and Pvc10 form a continuous central spike extending from the inner tube; Pvc11 (D) Initial models of Pvc1, Pvc2, Pvc9 and Pvc11 were built based onPDB: 4TV4, 3J9Q, 2IA7, 5HX2, respectively |
| 3 | 7lxz | 7ly2 | https://www.cell.com/cell-reports/pdf/S2211-1247(21)01401-7.pdf | Neutralizing antibody 5-7 defines a distinct site of vulnerability in SARS-CoV-2 spike N-terminal domain | 2021 | G Cerutti, Y Guo, P Wang, MS Nair, M Wang, Y Huang- Cell reports, 2021 - cell.com | We produced a structural superposition of all NTD-directed antibodies deposited in the PDB , superposed on NTD Ca atoms, in the context of SARS-CoV-2 spike trimer (Figure 2A). ... Figure S1. Sequence alignment for 5-7 with their corresponding germline genes, Related to Figures 1 and 2. 7LXZ McCallum et al., 2021 |
| 4 | 6vxx | - | https://www.tandfonline.com/doi/abs/10.1080/07391102.2020.1852117 | Virtual screening of phytoconstituents from miracle herb nigella sativa targeting nucleocapsid protein and papain-like protease of SARS-CoV-2 for COVID-19 | 2022 | S Siddiqui, S Upadhyay, R Ahmad- Structure and, 2022 - Taylor & Francis | spike glycoprotein (closed state, PDB ID: 6VXX ), spike glycoprotein (open state, PDB ID: structures were subjected to refinements and energy minimizations. Whole pdb structures of |
| 5 | 4w65 | - | https://www.mdpi.com/1420-3049/23/7/1555 | Isolation of -1, 3-Glucanase-Producing Microorganisms from Poria cocos Cultivation Soil via Molecular Biology | 2018 | Q Wu, X Dou, Q Wang, Z Guan, Y Cai, X Liao- Molecules, 2018 - mdpi.com | The glycoside hydrolase -1,3-glucanase, extensively distributed among plants, fungi, and bacteria, acts on 1,3--glucosidic bonds of structural -1,3-glucans to hydrolyze or transfer glycosides [1,2]. Based on the hydrolysis position, -1,3-glucanases are divided into endo-type |
| 6 | 6q07 | - | https://www.ncbi.nlm.nih.gov/pmc/articles/pmc8219949/ | In-Silico evidence for a two receptor based strategy of SARS-CoV-2 | 2021 | E Milanetti, M Miotto, L Di Rienzo- Frontiers in molecular, 2021 - ncbi.nlm.nih.gov | Complex between MERS spike protein and sialic acid: PDB code 6Q07 Unbound SARS-CoV spike protein: PDB code 6CRV We use DMS (Richards, 1977) to compute the solvent accessible surface for all proteins structure , given their x-ray structure in PDB format (Berman et al |
| 7 | 4zju | 4zr8, 5ha4 | https://www.tandfonline.com/doi/abs/10.1080/07391102.2018.1451387 | Screening of Potential Lead Molecules Against Prioritized Targets of Multi-Drug Resistant Acinetobacter Baumannii- Insights From Molecular Docking, Molecular Dynamic | 2018 | S Skariyachan, M Manjunath- Biomolecular Structure, 2018 - Taylor & Francis | Fourteen potential drug targets were screened based on their functional role in various biosynthetic pathways and the 3D structures of 9 The study suggests that the aforementioned lead candidates and targets can be used for structure -based drug screening towards MDR A |
| 8 | 3d6b | 3ii9 | http://pubs.acs.org/doi/abs/10.1021/ja908555n | User-loaded SlipChip for equipment-free multiplexed nanoliter-scale experiments | 2009 | L Li, W Du, R Ismagilov - Journal of the American Chemical Society, 2009 - ACS Publications | ... These crystals yielded a structure of 2.2 ? resolution and space group P2 1 2 1 2 1 (PDBid3D6B). Without ... manuscript. We thank Bart Staker for checking the structure of glutaryl-CoA dehydrogenase for PDB deposition. Supporting Information ... |
| 9 | 6q04 | - | https://www.sciencedirect.com/science/article/pii/S0079610720301103 | Human coronavirus spike protein-host receptor recognition | 2020 | L Guruprasad- Progress in biophysics and molecular biology, 2020 - Elsevier | cause infection. In this review, we discuss structural features of HCoV spike proteins and recognition of host proteins and carbohydrate receptors. Keywords. Human coronavirus. SARS-CoV. SARS-CoV-2. MERS-CoV. HCoV-HKU1. |
| 10 | 2lwk | - | https://onlinelibrary.wiley.com/doi/abs/10.1002/advs.202004379 | Light-Driven Cascade Mitochondria-to-Nucleus Photosensitization in Cancer Cell Ablation | 2021 | KN Wang, LY Liu, G Qi, XJ Chao, W Ma, Z Yu- Advanced, 2021 - Wiley Online Library | Herein, a light-driven, mitochondria-to-nucleus cascade dual organelle cancer cell ablation strategy is reported. structure of BT-Ir and DNA structure (5-CAATCGGATCGAATTCGATCCGATTG- 3, PDB code: 5ju4) and RNA structure (5- GAGUAGAAACAAGGCUUCGG CCUGCUUUUGCU-3, PDB code: 2lwk ) using AutoDock 4.2 |