We are actively tracking the number of publications by the scientific community which reference our structures, whether in the main text, figure captions or supplementary material. Selected articles are manually reviewed. Publications by SSGCID authors are excluded from the manually reviewed list. From our manual curation results, we estimate that the false positive rate might be as high as 50% for some structures.
This list was obtained from Google Scholar searches using an API provided by Christian Kreibich.
| Structure | Year released | #citations |
|---|---|---|
| 3EOO | 2008 | 17 |
| 3EZ4 | 2008 | 2 |
| 3EZO | 2008 | 3 |
| 3F0D | 2008 | 7 |
| 3F0F | 2008 | 3 |
| 3F0G | 2008 | 7 |
| 3F9I | 2008 | 12 |
| 3FDZ | 2009 | 12 |
| 3FQ3 | 2009 | 7 |
| 3FS2 | 2009 | 3 |
| # | PDB | Additional SSGCID structures cited | Link | Title | Year | Citation | Highlighted abstract |
|---|---|---|---|---|---|---|---|
| 1 | 2lwk | - | https://chemrxiv.org/ndownloader/files/25634519 | DrugPred_RNAStructure-based druggability predictions for RNA binding sites | 2020 | IH Rekand, R Brenk - 2020 - chemrxiv.org | However, the structure of the complex has been determined by NMR and it is possible that the resolution of the structure is not accurate enough to reveal the actual details of the binding mode.51 The Spinach Figure 6: Binder of influenza A promoter region ( PDB ID 2lwk ) |
| 2 | 2lwk | - | https://onlinelibrary.wiley.com/doi/abs/10.1002/advs.202004379 | Light-Driven Cascade Mitochondria-to-Nucleus Photosensitization in Cancer Cell Ablation | 2021 | KN Wang, LY Liu, G Qi, XJ Chao, W Ma, Z Yu- Advanced, 2021 - Wiley Online Library | Herein, a light-driven, mitochondria-to-nucleus cascade dual organelle cancer cell ablation strategy is reported. structure of BT-Ir and DNA structure (5-CAATCGGATCGAATTCGATCCGATTG- 3, PDB code: 5ju4) and RNA structure (5- GAGUAGAAACAAGGCUUCGG CCUGCUUUUGCU-3, PDB code: 2lwk ) using AutoDock 4.2 |
| 3 | 2lwk | - | https://www.sciencedirect.com/science/article/pii/S0168945218302693 | RNA on the move: the plasmodesmata perspective | 2018 | BC Reagan, EE Ganusov, JC Fernandez, TN McCray- Plant Science, 2018 - Elsevier | While this synthetic RNA consists of only 32 nucleotides, it has a corresponding radius of gyration of 15.48 Å (1.548 nm) when bound to the small molecule DPQ (6,7-dimethoxy-2-(piperazin-1-yl)quinazolin-4-amine) (PDB ID: 2LWK) |
| 4 | 2lxf | - | https://baylor-ir.tdl.org/handle/2104/10322 | Machine Learning-assisted Prediction of Structure and Function of Cystine-stabilized Peptides and Optimization of Expression in an E. coli System | 2018 | SMA Islam - 2018 - search.proquest.com | Each type is annotated with its name, PDB id, function and jmol estimated average 3D structural distance between disulfide bonds PBS Phosphate buffered saline PDB Protein data bank QSAR Quantitative structure activity relationship QSO Quasi-sequence-order |
| 5 | 2m4y | - | http://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1004960 | Theoretical Insights into the Biophysics of Protein Bi-stability and Evolutionary Switches | 2016 | T Sikosek, H Krobath, HS Chan - PLoS Comput Biol, 2016 - journals.plos.org | ... (f) Rubredoxin type protein from Mycobacterium ulcerans (PDB:2M4Y). (g) Pancreatic secretory trypsin inhibitor (Kazal type) variant 3 (PDB:1HPT) ... |
| 6 | 2mcq | 2kz0 | http://proteinsf.jbc.org/highwire/filestream/4748/field_highwire_article_pdf/0/j... | Structural and spectroscopic insights into | 2014 | N Rouhier, C Didierjean, BZ Couturier, MK Johnson - 2014 - ASBMB | ... it seems also that the side-chain of an arginine residue (R127 in AtBolA1) present in α3-helixis involved in tertiary structure maintenance (Fig. ... Accordingly, in Ehrlichia chaffeensis andRickettsia prowazekii BolA structures (pdb entry 2KZ0 and 2MCQ respectively), two ... |
| 7 | 2mj3 | - | https://www.frontiersin.org/articles/10.3389/fenrg.2019.00079/abstract | Evolutionary relationships between low potential ferredoxin and flavodoxin electron carriers | 2019 | IJ Campbell, GN Bennett, JJ Silberg- Frontiers in Energy Research, 2019 - frontiersin.org | This bioinformatic study highlights understudied PECs whose structure , stability, and partner specificity should be 1CZP, 2WLB, 3LXF, 1B9R, 1UWM, 1PDX, 1M2D, 1I7H, 3AH7, 2MJD, 2MJ3 , 2Y5C, 5FFI For Flds, we used PDB IDs 2FZ5, 1FLD, 4HEQ, 2HNA, 2FX2, 3F6R, 3KAP |
| 8 | 2mj3 | - | https://scholarship.rice.edu/handle/1911/108341 | Understanding and modulating electron transfer through ferredoxins | 2020 | I Campbell - 2020 - scholarship.rice.edu | 3.6. Cyanophage Fd structural characterization ..... 79 This bioinformatic study highlights understudied PECs whose structure , stability, and partner specificity should be further characterized... 1UWM, 1PDX, 1M2D, 1I7H, 3AH7, 2MJD, 2MJ3, 2Y5C, 5FFI, 3P1M, 1E0Z, 1DOI |
| 9 | 2mj3 | - | https://www.duo.uio.no/handle/10852/45840 | Structural and functional characterisation of ferredoxins in Bacillus cereus | 2015 | S Monka - 2015 - duo.uio.no | ...as well as testing out models generated from several homologous PDB-structures. This server generated models from 10 PDB files (1I7H, 3AH7, 3ZYY, 1KRH, 3N9Z, 2MJ3, 3HUI, 2Y5C, 1JQ4, 2WLB15) and generated two models from each by using two different programs SCULPTURE and MOLREP. ... |
| 10 | 2mu0 | 2kok | https://pubs.acs.org/doi/abs/10.1021/acs.biochem.0c00651 | Isofunctional Clustering and Conformational Analysis of the Arsenate Reductase Superfamily Reveals Nine Distinct Clusters | 2020 | MR Rosen, JB Leuthaeuser, CA Parish, JS Fetrow- Biochemistry, 2020 - ACS Publications | Arsenate reductase (ArsC) is a superfamily of enzymes that reduce arsenate. Due to active site similarities, some ArsC can function as low-molecular weight protein tyrosine phosphatases (LMW-PTPs).... We performed MD simulations to better understand the conformational behavior of each of the nine classes of proteins identified by autoMISST. Starting structures for these simulations were obtained from the following data available in the RCSB PDB:34 group 3AAA, 2KOK (chain A); group 4AA, 2MU0 (chain A); gro |