We are actively tracking the number of publications by the scientific community which reference our structures, whether in the main text, figure captions or supplementary material. Selected articles are manually reviewed. Publications by SSGCID authors are excluded from the manually reviewed list. From our manual curation results, we estimate that the false positive rate might be as high as 50% for some structures.
This list was obtained from Google Scholar searches using an API provided by Christian Kreibich.
| # | PDB | Additional SSGCID structures cited | Link | Title | Year | Citation | Highlighted abstract |
|---|---|---|---|---|---|---|---|
| 1 | 6pqh | - | https://www.sciencedirect.com/science/article/pii/S0969212621001647 | Structural study of the N-terminal domain of human MCM8/9 complex | 2021 | J Li, D Yu, L Liu, H Liang, Q Ouyang, Y Liu- Structure, 2021 - Elsevier | Journal home page for Structure . Article. Structural study of the N-terminal domain of human MCM8/9 complex Show more Share. Cite Highlights. The heterohexameric NTD structure combined crystal structures with cryo-EM map. ...Some other structures with less than 2.0 Å RMSD include DNA-directed DNA polymerase III (PDB: 3F2B), asparagine-tRNA ligase (PDB: 6PQH), replication protein A (PDB: 2K5V), telomerase-associated protein |
| 2 | 5dvw | - | https://www.intechopen.com/online-first/docking-based-screening-of-cell-penetrat... | Docking-Based Screening of Cell-Penetrating Peptides with Antiviral Features and Ebola Virus Proteins as a Drug Discovery Approach to Develop a | 2021 | E Raoufi, B Bahramimeimandi- Viral, 2021 - intechopen.com | The potential reservoirs of EBOV RNA are three species of African fruit bats [3]. The genome of this virus contains a negative-strand RNA that encodes six structural and one non- structural proteins, which can be employed as potential drug targets, including transmembrane ... The structures of GP (PDBID: 5JQB), VP35 (PDBID: 3FKE), VP24 (PDBID: 4M0Q), VP30 (PDBID: 5DVW), VP40 (PDBID: 4LDB) and NP (PDBID: 4Z9P) proteins of EBOV were collected from Protein Data Bank |
| 3 | 4hr2 | - | https://www.nature.com/articles/s41594-020-00530-0 | Structures of radial spokes and associated complexes important for ciliary motility | 2021 | M Gui, M Ma, E Sze-Tu, X Wang, F Koh- Nature Structural &, 2021 - nature.com | In motile cilia, a mechanoregulatory network is responsible for converting the action of thousands of dynein motors bound to doublet microtubules into a single propulsive waveform. Here, we use two complementary cryo-EM strategies to determine structures of the major |
| 4 | 3tcq | - | https://link.springer.com/article/10.1007/s00894-021-04682-8 | Targeting ebola virus VP40 protein through novel inhibitors: exploring the structural and dynamic perspectives on molecular landscapes | 2021 | S Khan, Z Fakhar, A Ahmad- Journal of Molecular Modeling, 2021 - Springer | of novel antiviral drugs. Computational methods. Structural modelling. The X-ray crystallographic structure of VP40 protein ( PDB Code: 3TCQ ) [12] was retrieved from the Protein Data Bank (www.rcsb.org). The structure was prepared |
| 5 | 6q05 | - | https://www.sciencedirect.com/science/article/pii/S1093326320305672 | Exploring the intrinsic dynamics of SARS-CoV-2, SARS-CoV and MERS-CoV spike glycoprotein through normal mode analysis using anisotropic network | 2021 | S Majumder, D Chaudhuri, J Datta, K Giri- Journal of Molecular Graphics, 2021 - Elsevier | 2.1. Protein structure retrieval. All the X-ray crystal structures for SARS-CoV-2, SARS-CoV and MERS-CoV S proteins in the lying state were taken from protein data bank [21]. The corresponding PDB IDs are 6VXX, 5X58 and 6Q05 respectively [11,22,23] |
| 6 | 6u94 | - | https://www.biorxiv.org/content/10.1101/2021.08.17.456619.abstract | Genome sequencing of 196 Treponema pallidum strains from six continents reveals additional variability in vaccine candidate genes and dominance of Nichols clade | 2021 | NAP Lieberman, MJ Lin, H Xie, L Shretha, T Nguyen- bioRxiv, 2021 - biorxiv.org | guided by the top 1-7 templates for each target. We used the following templates in modelling each target: TP0136 used 4a2l and 5oj5; TP0326 used 4k3b and 5d0o; TP0548 used 6h3i; TP0966 used 1yc9, 3d5k, 4k7r, 4mt0, 4mt4, 5azs, and 6u94; TP0967 used 1yc9, 3d5k, 5azp, 5azs, and 6u94. |
| 7 | 4gl8 | - | https://journals.plos.org/plospathogens/article?id=10.1371/journal.ppat.1009180 | Host-specific functional compartmentalization within the oligopeptide transporter during the Borrelia burgdorferi enzootic cycle | 2021 | AM Groshong, MA McLain, JD Radolf- PLoS pathogens, 2021 - journals.plos.org | Structural homology models demonstrated variations within the binding pockets of OppA1, 2, and 5 indicative of different peptide repertoires We used larval immersion feeding [43] to confirm that oppA1 is essential for structural integrity of the spirochete during the blood meal |
| 8 | 6xdh | - | https://academic.oup.com/bib/article-abstract/22/2/769/6067883 | SARS-CoV-2 3D database: understanding the coronavirus proteome and evaluating possible drug targets | 2021 | AF Alsulami, SE Thomas, AR Jamasb- Briefings in, 2021 - academic.oup.com | release of the SARS-CoV-2 genome sequence in March 2020, there has been an international focus on developing target-based drug discovery, which also requires knowledge of the 3D structure of the proteome. Where there are no experimentally solved structures , our group ... (v) Nsp15 (Uridylate specific endoribonuclease)—PDB Id: 6XDH. |
| 9 | 6wps | - | https://www.biorxiv.org/content/10.1101/2021.01.25.427846v1.abstract | SARS-CoV-2 receptor binding mutations and antibody mediated immunity. | 2021 | M Mejdani, K Haddadi, C Pham, R Mahadevan- BioRxiv, 2021 - biorxiv.org | 39 ( PDB : 7JMP), CV07- 250 ( PDB : 6XKQ), P2B-2F6 ( PDB : 7BWJ), CV07-270 ( PDB : 6XKP), BD-368-2 ( PDB : 7CHE), and S309 ( PDB : 6WPS ) 53 Laskowski, RA PDBsum: summaries and analyses of PDB structures Fig.1: Structure of SARS-CoV-2 RBD bound to ACE2 receptor |
| 10 | 2lwk | - | https://onlinelibrary.wiley.com/doi/abs/10.1002/advs.202004379 | Light-Driven Cascade Mitochondria-to-Nucleus Photosensitization in Cancer Cell Ablation | 2021 | KN Wang, LY Liu, G Qi, XJ Chao, W Ma, Z Yu- Advanced, 2021 - Wiley Online Library | Herein, a light-driven, mitochondria-to-nucleus cascade dual organelle cancer cell ablation strategy is reported. structure of BT-Ir and DNA structure (5-CAATCGGATCGAATTCGATCCGATTG- 3, PDB code: 5ju4) and RNA structure (5- GAGUAGAAACAAGGCUUCGG CCUGCUUUUGCU-3, PDB code: 2lwk ) using AutoDock 4.2 |