We are actively tracking the number of publications by the scientific community which reference our structures, whether in the main text, figure captions or supplementary material. Selected articles are manually reviewed. Publications by SSGCID authors are excluded from the manually reviewed list. From our manual curation results, we estimate that the false positive rate might be as high as 50% for some structures.
This list was obtained from Google Scholar searches using an API provided by Christian Kreibich.
| # | PDB | Additional SSGCID structures cited | Link | Title | Year | Citation | Highlighted abstract |
|---|---|---|---|---|---|---|---|
| 1 | 7jzl | 7jzn | https://pubs.acs.org/doi/abs/10.1021/acs.jcim.1c00766 | Allosteric Control of Structural Mimicry and Mutational Escape in the SARS-CoV-2 Spike Protein Complexes with the ACE2 Decoys and Miniprotein Inhibitors: A | 2021 | GM Verkhivker, S Agajanian, DY Oztas- Journal of Chemical, 2021 - ACS Publications | Allosteric Control of Structural Mimicry and Mutational Escape in the SARS-CoV-2 Spike Protein Complexes with the ACE2 Decoys and Miniprotein Inhibitors: A Network-Based Approach for Mutational Profiling of Binding and Signaling |
| 2 | 3uve | - | https://www.biorxiv.org/content/10.1101/2021.08.17.456622.abstract | Nicotinate degradation in a microbial eukaryote: a novel, complete pathway extant in Aspergillus nidulans | 2021 | E Bokor, J Amon, M Varga, A Szekeres, Z Hegedus- bioRxiv, 2021 - biorxiv.org | 372 code: 3awd) and carveol dehydrogenase CDH from Mycobacterium avium ( PDB code: 3uve model of HxnN with its closest known 426 structural homolog, FAAH1 ( PDB code: 2vya), |
| 3 | 2lwk | - | https://onlinelibrary.wiley.com/doi/abs/10.1002/advs.202004379 | Light-Driven Cascade Mitochondria-to-Nucleus Photosensitization in Cancer Cell Ablation | 2021 | KN Wang, LY Liu, G Qi, XJ Chao, W Ma, Z Yu- Advanced, 2021 - Wiley Online Library | Herein, a light-driven, mitochondria-to-nucleus cascade dual organelle cancer cell ablation strategy is reported. structure of BT-Ir and DNA structure (5-CAATCGGATCGAATTCGATCCGATTG- 3, PDB code: 5ju4) and RNA structure (5- GAGUAGAAACAAGGCUUCGG CCUGCUUUUGCU-3, PDB code: 2lwk ) using AutoDock 4.2 |
| 4 | 6wpt | - | https://advances.sciencemag.org/content/7/16/eabf3671?utm_campaign=TrendMD_1&utm... | The SARS-CoV-2 spike variant D614G favors an open conformational state | 2021 | RA Mansbach, S Chakraborty, K Nguyen- Science, 2021 - advances.sciencemag.org | 1 Structural representation of the Spike protein. (A) The Spike complex is shown in the all-down conformation. Its S1 and S2 subunits are depicted in red and blue We display the domains highlighted in the Spike structure , shown from two different perspectives ... S309 Fab binding to up-RBD was modeled by rigid-body alignment to closed-RBD and Fab interactions from PDB structure 6WPT (21), using the backbone of residues 331 to 527 for least squares fitting. |
| 5 | 6nb6 | - | https://www.annualreviews.org/doi/abs/10.1146/annurev-biophys-062920-063711 | Review of COVID-19 antibody therapies | 2021 | J Chen, K Gao, R Wang, DD Nguyen- Annual review of, 2021 - annualreviews.org | S230 SARS-CoV RBD IgG = 0.06 / BLI (73) 6NB6 (73) 4.30 Three-Dimensional Structure Alignment All of the available 3D structures of the SARS-CoV-2 S-protein RBD in complex with antibod- ies are aligned to ACE2 The PDB ID of these complexes can be found in Table 1 |
| 6 | 7k43 | 7k4n | https://pubs.acs.org/doi/abs/10.1021/acs.jpcb.1c00395 | Integrated Biophysical Modeling of the SARS-CoV-2 Spike Protein Binding and Allosteric Interactions with Antibodies | 2021 | GM Verkhivker, L Di Paola- The Journal of Physical Chemistry B, 2021 - ACS Publications | Structural and biochemical studies of the severe acute respiratory syndrome (SARS)-CoV-2 spike glycoproteins and complexes with highly potent antibodies have revealed multiple conformation-dependen... |
| 7 | 6pqh | - | https://www.sciencedirect.com/science/article/pii/S0969212621001647 | Structural study of the N-terminal domain of human MCM8/9 complex | 2021 | J Li, D Yu, L Liu, H Liang, Q Ouyang, Y Liu- Structure, 2021 - Elsevier | Journal home page for Structure . Article. Structural study of the N-terminal domain of human MCM8/9 complex Show more Share. Cite Highlights. The heterohexameric NTD structure combined crystal structures with cryo-EM map. ...Some other structures with less than 2.0 Å RMSD include DNA-directed DNA polymerase III (PDB: 3F2B), asparagine-tRNA ligase (PDB: 6PQH), replication protein A (PDB: 2K5V), telomerase-associated protein |
| 8 | 4npc | - | https://www.sciencedirect.com/science/article/pii/S135951132100088X | Characterization of xylitol 4-dehydrogenase from Erwinia aphidicola and its co-expression with NADH oxidase in Bacillus subtilis | 2021 | M Li, W Zhu, Q Meng, M Miao, T Zhang- Process Biochemistry, 2021 - Elsevier | XDH, EC 1.1.1.B19) catalyzes the interconversion of xylitol and l-xylulose [11], and its primary structure is highly Computer simulation and analysis facilitated the extraction of potential structural information, which may help us further investigate the catalytic mechanism of XDH ... and the crystal structure of sorbitol dehydrogenase from Brucella suis as a template (PDB ID: 4NPC). The quality of the model was evaluated using the SAVES server. Molecular docking was conducted using Autodock |
| 9 | 6x79 | - | https://www.biorxiv.org/content/10.1101/2021.02.17.431625v1.abstract | A rigorous framework for detecting SARS-CoV-2 spike protein mutational ensemble from genomic and structural features | 2021 | S Fatihi, S Rathore, A Pathak, D Gahlot, M Mukerji- bioRxiv, 2021 - biorxiv.org | Cryo-EM structures of the D614G spike structure have revealed that the mutant D614 is stable with RBD in an up mational states of the spike were analysed (see Methods for PDB ids) spike conformers showed large structural changes, with an average deviation of 2.77 0.42 ... 18 cryo-EM structures for closed spike conformation (PDB ID: 6ZGE, 6VXX, 6X2C, 6X6P, 6X29, 6X79, 6XF5, 6XLU, 6XM5, 6ZB4, 6ZB5, 6ZGI, 6ZP0, 7CAB, 7DDD, 7DF3, 7JJI and 7JWY) were taken from RCSB P |
| 10 | 3tcq | - | https://link.springer.com/article/10.1007/s00894-021-04682-8 | Targeting ebola virus VP40 protein through novel inhibitors: exploring the structural and dynamic perspectives on molecular landscapes | 2021 | S Khan, Z Fakhar, A Ahmad- Journal of Molecular Modeling, 2021 - Springer | of novel antiviral drugs. Computational methods. Structural modelling. The X-ray crystallographic structure of VP40 protein ( PDB Code: 3TCQ ) [12] was retrieved from the Protein Data Bank (www.rcsb.org). The structure was prepared |