We are actively tracking the number of publications by the scientific community which reference our structures, whether in the main text, figure captions or supplementary material. Selected articles are manually reviewed. Publications by SSGCID authors are excluded from the manually reviewed list. From our manual curation results, we estimate that the false positive rate might be as high as 50% for some structures.
This list was obtained from Google Scholar searches using an API provided by Christian Kreibich.
| Structure | Year released | #citations |
|---|---|---|
| 3EG4 | 2008 | 8 |
| 3EIY | 2008 | 8 |
| 3EJ0 | 2008 | 5 |
| 3EJ2 | 2008 | 4 |
| 3EK1 | 2008 | 11 |
| 3EK2 | 2008 | 11 |
| 3EMJ | 2008 | 3 |
| 3ENK | 2008 | 11 |
| 3ENN | 2008 | 5 |
| 3EOL | 2008 | 8 |
| # | PDB | Additional SSGCID structures cited | Link | Title | Year | Citation | Highlighted abstract |
|---|---|---|---|---|---|---|---|
| 1 | 2lwk | - | https://chemrxiv.org/ndownloader/files/25634519 | DrugPred_RNAStructure-based druggability predictions for RNA binding sites | 2020 | IH Rekand, R Brenk - 2020 - chemrxiv.org | However, the structure of the complex has been determined by NMR and it is possible that the resolution of the structure is not accurate enough to reveal the actual details of the binding mode.51 The Spinach Figure 6: Binder of influenza A promoter region ( PDB ID 2lwk ) |
| 2 | 2lwk | - | https://portal.ichb.pl/wp-content/uploads/2023/02/Doktorat_AleksandraJarmoowicz.... | Small molecules interacting with Influenza virus RNA and SARS-CoV-2 RNA as potential inhibitors of replication | 2022 | A Jarmoowicz - portal.ichb.pl | M121 structural motif of segment 5 (+)RNA secondary structure was investigated by importance of the conserved secondary structure of mentioned structural motif and suggest that it |
| 3 | 2lwk | - | http://www.mdpi.com/1422-0067/17/6/779/htm | Recent Advances in Developing Small Molecules Targeting Nucleic Acid | 2016 | M Wang, Y Yu, C Liang, A Lu, G Zhang - International journal of molecular , 2016 - mdpi.com | ... Figure 12A) consists of a planar ring, an amino sugar structure and a fused cyclohexane ringsystem. A lot of structural studies have been investigated to understand the interaction betweenDNA duplex and molecule [28,46,47,48,49,50,51]. Most of the structures indicate that ... |
| 4 | 2lwk | - | http://pubs.acs.org/doi/abs/10.1021/acs.jcim.5b00593 | Can Holo NMR Chemical Shifts be Directly Used to Resolve RNA-Ligand Poses? | 2016 | AT Frank - Journal of Chemical Information and Modeling, 2016 - ACS Publications | ... shift data within standard procedures to aid in efficiently determining the 3D structure ofRNA-ligand complexes by acting as an additional source of structural information that is 4 Page4 of 30 ... promoter-DPQ complex (PDBID: 2LWK, BMRBID: 18633)37 (see Fig. 1). ... |
| 5 | 2lwk | - | https://link.springer.com/chapter/10.1007/7355_2016_20 | Viral RNA targets and their small molecule ligands | 2017 | T Hermann- RNA Therapeutics, 2017 - Springer | disrupt or stabilize the RNA hairpin and thereby affect the equilibrium between translation of structural and enzymatically The three-dimensional structure of the FFS RNA in complex with a synthetic compound has been The added tetraloop is indicated in grey ( PDB : 2LWK ) [34] |
| 6 | 2lwk | - | http://pubs.acs.org/doi/abs/10.1021/jp407254m | Prediction of RNA 1H and 13C chemical shifts: a structure based approach | 2013 | AT Frank, SH Bae, AC Stelzer - The Journal of Physical Chemistry …, 2013 - ACS Publications | ... which 1 H and 13 C chemical shifts data were acquired, and a structural description. ... each chemicalshift entry was mapped to local 3D descriptors calculated from PDB coordinates. ... 1 H chemicalshifts for the nuclei corresponding to those in our chemical shift-structure database. ... |
| 7 | 2lwk | - | http://onlinelibrary.wiley.com/doi/10.1002/wrna.1373/full | Small molecules targeting viral RNA | 2016 | T Hermann - Wiley Interdisciplinary Reviews: RNA, 2016 - Wiley Online Library | ... The added tetraloop is indicated in gray. (c) Detail view of the ligand binding site in theNMR model, showing hydrogen atoms of the ligand 11. Structure images were preparedfrom PDB coordinate file 2LWK.[48]. Download figure to PowerPoint. ... |
| 8 | 2lwk | - | https://onlinelibrary.wiley.com/doi/abs/10.1002/advs.202004379 | Light-Driven Cascade Mitochondria-to-Nucleus Photosensitization in Cancer Cell Ablation | 2021 | KN Wang, LY Liu, G Qi, XJ Chao, W Ma, Z Yu- Advanced, 2021 - Wiley Online Library | Herein, a light-driven, mitochondria-to-nucleus cascade dual organelle cancer cell ablation strategy is reported. structure of BT-Ir and DNA structure (5-CAATCGGATCGAATTCGATCCGATTG- 3, PDB code: 5ju4) and RNA structure (5- GAGUAGAAACAAGGCUUCGG CCUGCUUUUGCU-3, PDB code: 2lwk ) using AutoDock 4.2 |
| 9 | 2lwk | - | https://deepblue.lib.umich.edu/handle/2027.42/155127 | Using Machine Learning to Better Predict the Structure of RNA and RNA Containing Complexes | 2020 | S Chhabra - 2020 - deepblue.lib.umich.edu | 53 3.5 Top 10 RNA Structures for 2LWK predicted from sequence using CS-Fold and Rosetta structures . The statistics from Protein Data Bank ( PDB ) (http://www.rcsb.org) current understanding of the RNA structure -function relationships is limited due to |
| 10 | 2lwk | - | http://www.sciencedirect.com/science/article/pii/S0006349515011601 | Predicting 3D Structure, Flexibility, and Stability of RNA Hairpins in Monovalent and Divalent Ion Solutions | 2015 | YZ Shi, L Jin, FH Wang, XL Zhu, ZJ Tan - Biophysical journal, 2015 - Elsevier | TABLE 1 The 32 RNA Molecules for 3D Structure Prediction in This Work 26 2LWK ... |