We are actively tracking the number of publications by the scientific community which reference our structures, whether in the main text, figure captions or supplementary material. Selected articles are manually reviewed. Publications by SSGCID authors are excluded from the manually reviewed list. From our manual curation results, we estimate that the false positive rate might be as high as 50% for some structures.
This list was obtained from Google Scholar searches using an API provided by Christian Kreibich.
| Structure | Year released | #citations |
|---|---|---|
| 3EG4 | 2008 | 9 |
| 3EIY | 2008 | 8 |
| 3EJ0 | 2008 | 5 |
| 3EJ2 | 2008 | 4 |
| 3EK1 | 2008 | 11 |
| 3EK2 | 2008 | 11 |
| 3EMJ | 2008 | 3 |
| 3ENK | 2008 | 12 |
| 3ENN | 2008 | 5 |
| 3EOL | 2008 | 8 |
| # | PDB | Additional SSGCID structures cited | Link | Title | Year | Citation | Highlighted abstract |
|---|---|---|---|---|---|---|---|
| 1 | 2lwk | - | https://chemrxiv.org/ndownloader/files/25634519 | DrugPred_RNAStructure-based druggability predictions for RNA binding sites | 2020 | IH Rekand, R Brenk - 2020 - chemrxiv.org | However, the structure of the complex has been determined by NMR and it is possible that the resolution of the structure is not accurate enough to reveal the actual details of the binding mode.51 The Spinach Figure 6: Binder of influenza A promoter region ( PDB ID 2lwk ) |
| 2 | 2lwk | - | https://onlinelibrary.wiley.com/doi/abs/10.1002/advs.202004379 | Light-Driven Cascade Mitochondria-to-Nucleus Photosensitization in Cancer Cell Ablation | 2021 | KN Wang, LY Liu, G Qi, XJ Chao, W Ma, Z Yu- Advanced, 2021 - Wiley Online Library | Herein, a light-driven, mitochondria-to-nucleus cascade dual organelle cancer cell ablation strategy is reported. structure of BT-Ir and DNA structure (5-CAATCGGATCGAATTCGATCCGATTG- 3, PDB code: 5ju4) and RNA structure (5- GAGUAGAAACAAGGCUUCGG CCUGCUUUUGCU-3, PDB code: 2lwk ) using AutoDock 4.2 |
| 3 | 2lwk | - | https://link.springer.com/chapter/10.1007/7355_2016_20 | Viral RNA targets and their small molecule ligands | 2017 | T Hermann- RNA Therapeutics, 2017 - Springer | disrupt or stabilize the RNA hairpin and thereby affect the equilibrium between translation of structural and enzymatically The three-dimensional structure of the FFS RNA in complex with a synthetic compound has been The added tetraloop is indicated in grey ( PDB : 2LWK ) [34] |
| 4 | 2lwk | - | https://deepblue.lib.umich.edu/handle/2027.42/155127 | Using Machine Learning to Better Predict the Structure of RNA and RNA Containing Complexes | 2020 | S Chhabra - 2020 - deepblue.lib.umich.edu | 53 3.5 Top 10 RNA Structures for 2LWK predicted from sequence using CS-Fold and Rosetta structures . The statistics from Protein Data Bank ( PDB ) (http://www.rcsb.org) current understanding of the RNA structure -function relationships is limited due to |
| 5 | 2lwk | - | https://portal.ichb.pl/wp-content/uploads/2023/02/Doktorat_AleksandraJarmoowicz.... | Small molecules interacting with Influenza virus RNA and SARS-CoV-2 RNA as potential inhibitors of replication | 2022 | A Jarmoowicz - portal.ichb.pl | M121 structural motif of segment 5 (+)RNA secondary structure was investigated by importance of the conserved secondary structure of mentioned structural motif and suggest that it |
| 6 | 2lwk | - | http://pubs.acs.org/doi/abs/10.1021/jp407254m | Prediction of RNA 1H and 13C chemical shifts: a structure based approach | 2013 | AT Frank, SH Bae, AC Stelzer - The Journal of Physical Chemistry …, 2013 - ACS Publications | ... which 1 H and 13 C chemical shifts data were acquired, and a structural description. ... each chemicalshift entry was mapped to local 3D descriptors calculated from PDB coordinates. ... 1 H chemicalshifts for the nuclei corresponding to those in our chemical shift-structure database. ... |
| 7 | 2lwk | - | https://www.sciencedirect.com/science/article/pii/S0168945218302693 | RNA on the move: the plasmodesmata perspective | 2018 | BC Reagan, EE Ganusov, JC Fernandez, TN McCray- Plant Science, 2018 - Elsevier | While this synthetic RNA consists of only 32 nucleotides, it has a corresponding radius of gyration of 15.48 Å (1.548 nm) when bound to the small molecule DPQ (6,7-dimethoxy-2-(piperazin-1-yl)quinazolin-4-amine) (PDB ID: 2LWK) |
| 8 | 2lwk | - | https://www.biorxiv.org/content/biorxiv/early/2021/01/10/2021.01.10.426061/DC1/e... | Supporting Information for Occurrences of protonated base triples in RNA are determined by their cooperative binding energies and specific functional | 2021 | A Halder, A Jhunjhunwala, D Bhattacharyya, A Mitra - biorxiv.org | Figure S1: Context of occurrences of G(CC) H:+ Trans/W:W Cis triple (System 2). 2D representation of (A) the 5S rRNA, (B) Domain III of 25S rRNA of S. cerevisiae and (C) HDV ribozyme are shown and the structural motifs that contain (G) 3D structure of the PDB : 3KIR Chain: A |
| 9 | 2lwk | - | https://books.google.com/books?hl=en&lr=&id=0dwBEAAAQBAJ&oi=fnd&pg=PA332&dq=%222... | Maicol Bissaro, Mattia Sturlese and Stefano Moro | 2020 | K Kuca, M Tutone, E Malinowska- In Silico Methods for Drug, 2020 - books.google.com | against the PDB reference.(B) Superimposition between the experimental NMR complex ( PDB ID 2LWK , green-colored RMSD of RNA phosphate atoms belonging to the backbone, computed against the PDB reference E) Flexibility characterizing the RNA structure during DPQ |
| 10 | 2lwk | - | http://onlinelibrary.wiley.com/doi/10.1002/wrna.1373/full | Small molecules targeting viral RNA | 2016 | T Hermann - Wiley Interdisciplinary Reviews: RNA, 2016 - Wiley Online Library | ... The added tetraloop is indicated in gray. (c) Detail view of the ligand binding site in theNMR model, showing hydrogen atoms of the ligand 11. Structure images were preparedfrom PDB coordinate file 2LWK.[48]. Download figure to PowerPoint. ... |