We are actively tracking the number of publications by the scientific community which reference our structures, whether in the main text, figure captions or supplementary material. Selected articles are manually reviewed. Publications by SSGCID authors are excluded from the manually reviewed list. From our manual curation results, we estimate that the false positive rate might be as high as 50% for some structures.
This list was obtained from Google Scholar searches using an API provided by Christian Kreibich.
| Structure | Year released | #citations |
|---|---|---|
| 3KC6 | 2010 | 9 |
| 3KRS | 2009 | 9 |
| 3GVG | 2009 | 9 |
| 4G6C | 2012 | 9 |
| 4G7F | 2012 | 9 |
| 3MX6 | 2010 | 9 |
| 3QBP | 2011 | 9 |
| 3PME | 2010 | 9 |
| 3UF8 | 2011 | 9 |
| 4NPS | 2014 | 9 |
| # | PDB | Additional SSGCID structures cited | Link | Title | Year | Citation | Highlighted abstract |
|---|---|---|---|---|---|---|---|
| 1 | 4j3g | - | https://www.nature.com/articles/s41477-017-0061-1 | Non-specific activities of the major herbicide-resistance gene BAR | 2017 | B Christ, R Hochstrasser, L Guyer, R Francisco- Nature plants, 2017 - nature.com | We report the crystal structures of BAR, and further delineate structural basis for its substrate selectivity and catalytic mechanism... The search model was an ensemble model generated with Ensembler using eight protein structures homologous to BAR (PBD codes and % identity to BAR: 2JLM (28%), 3DR8 (35%), 4J3G (31%), 4JXQ (33%), 4MBU ... |
| 2 | 3d6b | 3ii9 | http://pubs.acs.org/doi/abs/10.1021/ja908555n | User-loaded SlipChip for equipment-free multiplexed nanoliter-scale experiments | 2009 | L Li, W Du, R Ismagilov - Journal of the American Chemical Society, 2009 - ACS Publications | ... These crystals yielded a structure of 2.2 ? resolution and space group P2 1 2 1 2 1 (PDBid3D6B). Without ... manuscript. We thank Bart Staker for checking the structure of glutaryl-CoA dehydrogenase for PDB deposition. Supporting Information ... |
| 3 | 7jwk | 6mu0 | https://www.sciencedirect.com/science/article/pii/S002228362100588X | Building structural models of a whole mycoplasma cell | 2022 | M Maritan, L Autin, J Karr, MW Covert, AJ Olson- Journal of molecular, 2022 - Elsevier | PDB structure for a specific ingredient. Proteins with high sequence similarity and structural ... Ten of these experimental structures were used in our spatial model for the following gene products: MG396 (RpiB, 6MU0), MG027 (NusB, 1Q8C), MG191 .... The other four genes are only partially captured by experimentally-determined structures: MG200 (DnaJ-like, 4DCZ), MG238 (tig, 1HXV), MG301 (GapA, 7JWK), and MG469 (DnaA, 2JMP). |
| 4 | 6q04 | - | https://www.sciencedirect.com/science/article/pii/S0079610720301103 | Human coronavirus spike protein-host receptor recognition | 2020 | L Guruprasad- Progress in biophysics and molecular biology, 2020 - Elsevier | cause infection. In this review, we discuss structural features of HCoV spike proteins and recognition of host proteins and carbohydrate receptors. Keywords. Human coronavirus. SARS-CoV. SARS-CoV-2. MERS-CoV. HCoV-HKU1. |
| 5 | 2lwk | - | https://onlinelibrary.wiley.com/doi/abs/10.1002/advs.202004379 | Light-Driven Cascade Mitochondria-to-Nucleus Photosensitization in Cancer Cell Ablation | 2021 | KN Wang, LY Liu, G Qi, XJ Chao, W Ma, Z Yu- Advanced, 2021 - Wiley Online Library | Herein, a light-driven, mitochondria-to-nucleus cascade dual organelle cancer cell ablation strategy is reported. structure of BT-Ir and DNA structure (5-CAATCGGATCGAATTCGATCCGATTG- 3, PDB code: 5ju4) and RNA structure (5- GAGUAGAAACAAGGCUUCGG CCUGCUUUUGCU-3, PDB code: 2lwk ) using AutoDock 4.2 |
| 6 | 5k85 | 5ifi | https://www.nature.com/articles/s41467-020-14301-4 | ProtCID: A data resource for structural information on protein interactions | 2020 | Q Xu, RL Dunbrack- Nature communications, 2020 - nature.com | While the structure of full-length activated PAH has not been determined, a recent structure of the ACT domain of J9VFT1_CRYNH, E5XP76_9ACTN) and two common entries ( PDB : 5IFI [https://doi.org/10.2210/pdb5IFI/ pdb ] and 5K85 [https://doi.org/10.2210/pdb5K85/ pdb ]) |
| 7 | 6wps | 7jw0, 7jxe, 7jv2, 7k43, 7jvc | https://www.mdpi.com/965720 | Structural analysis of neutralizing epitopes of the SARS-CoV-2 spike to guide therapy and vaccine design strategies | 2021 | MT Finkelstein, AG Mermelstein, E Parker Miller- Viruses, 2021 - mdpi.com | Multiple structures of S in complex with ACE2 have been determined [9,17,21,22,26 S proteins from SARS-CoV, SARS-CoV-2, and MERS-CoV undergo dramatic structural changes to S2 forms an elongated structure , and the two heptad repeats, HR1 and HR2, eventually form a ... S2M11 from RBM Class III (PDB ID 7K43 [71]), and CR3022 (left) and S309 (right) from RBD Core (PDB IDs 6W41 [86] and PDB ID 6WPS [ |
| 8 | 4ix8 | - | https://febs.onlinelibrary.wiley.com/doi/abs/10.1002/2211-5463.12441 | Bioinformatic analysis of the fold type I PLPdependent enzymes reveals determinants of reaction specificity in lthreonine aldolase from Aeromonas jandaei | 2018 | K Fesko, D Suplatov, V vedas- FEBS open bio, 2018 - Wiley Online Library | to account for structural and functional variability within a large superfamily. First, comparison of protein structures was implemented to study distant evolutionary relationships because structures are more conserved in evolution than sequences. Table 1. Conserved and FSPs in the aspartate aminotransferase superfamily. Tyrosine aminotransferase 4ix8 D253 |
| 9 | 4zju | 4zr8, 5ha4 | https://www.tandfonline.com/doi/abs/10.1080/07391102.2018.1451387 | Screening of Potential Lead Molecules Against Prioritized Targets of Multi-Drug Resistant Acinetobacter Baumannii- Insights From Molecular Docking, Molecular Dynamic | 2018 | S Skariyachan, M Manjunath- Biomolecular Structure, 2018 - Taylor & Francis | Fourteen potential drug targets were screened based on their functional role in various biosynthetic pathways and the 3D structures of 9 The study suggests that the aforementioned lead candidates and targets can be used for structure -based drug screening towards MDR A |
| 10 | 3r9r | - | https://royalsocietypublishing.org/doi/abs/10.1098/rsta.2018.0422 | Structure-guided fragment-based drug discovery at the synchrotron: screening binding sites and correlations with hotspot mapping | 2019 | SE Thomas, P Collins, RH James- of the Royal, 2019 - royalsocietypublishing.org | purine biosynthesis in maintaining the viability of cells and differences in the structural architecture of bacterial The crystals are similar to those of a previously determined structure of MabPurC with a monomer in the asymmetric unit (figure 1b) ( PDB 3R9R , Seattle Structural |