We are actively tracking the number of publications by the scientific community which reference our structures, whether in the main text, figure captions or supplementary material. Selected articles are manually reviewed. Publications by SSGCID authors are excluded from the manually reviewed list. From our manual curation results, we estimate that the false positive rate might be as high as 50% for some structures.
This list was obtained from Google Scholar searches using an API provided by Christian Kreibich.
| Structure | Year released | #citations |
|---|---|---|
| 6XDH | 2020 | 10 |
| 3QHD | 2011 | 10 |
| 3MX6 | 2010 | 10 |
| 3N58 | 2010 | 10 |
| 3NFW | 2010 | 10 |
| 3E5B | 2008 | 10 |
| 7N8I | 2021 | 10 |
| 3MQD | 2010 | 9 |
| 3JVH | 2009 | 9 |
| 3UF8 | 2011 | 9 |
| # | PDB | Additional SSGCID structures cited | Link | Title | Year | Citation | Highlighted abstract |
|---|---|---|---|---|---|---|---|
| 1 | 3oa1 | - | https://www.sciencedirect.com/science/article/pii/S1879625718301743 | Status of antiviral therapeutics against rabies virus and related emerging lyssaviruses | 2019 | V Du Pont, RK Plemper, MJ Schnell- Current opinion in virology, 2019 - Elsevier | RABV drug profiles, past efforts to address the problem and inhibitor candidates identified, and examine how the rapidly expanding structural insight into RABV protein organization has illuminated novel druggable target candidates ... The solved crystal structure for the N0 binding domain is depicted in teal (PDB 3OA1). The solved crystal structure for the dimerization domain is depicted in green and pink with both top and side views... |
| 2 | 6q07 | - | https://www.ncbi.nlm.nih.gov/pmc/articles/pmc8219949/ | In-Silico evidence for a two receptor based strategy of SARS-CoV-2 | 2021 | E Milanetti, M Miotto, L Di Rienzo- Frontiers in molecular, 2021 - ncbi.nlm.nih.gov | Complex between MERS spike protein and sialic acid: PDB code 6Q07 Unbound SARS-CoV spike protein: PDB code 6CRV We use DMS (Richards, 1977) to compute the solvent accessible surface for all proteins structure , given their x-ray structure in PDB format (Berman et al |
| 3 | 4ix8 | - | https://febs.onlinelibrary.wiley.com/doi/abs/10.1002/2211-5463.12441 | Bioinformatic analysis of the fold type I PLPdependent enzymes reveals determinants of reaction specificity in lthreonine aldolase from Aeromonas jandaei | 2018 | K Fesko, D Suplatov, V vedas- FEBS open bio, 2018 - Wiley Online Library | to account for structural and functional variability within a large superfamily. First, comparison of protein structures was implemented to study distant evolutionary relationships because structures are more conserved in evolution than sequences. Table 1. Conserved and FSPs in the aspartate aminotransferase superfamily. Tyrosine aminotransferase 4ix8 D253 |
| 4 | 3d6b | 3ii9 | http://pubs.acs.org/doi/abs/10.1021/ja908555n | User-loaded SlipChip for equipment-free multiplexed nanoliter-scale experiments | 2009 | L Li, W Du, R Ismagilov - Journal of the American Chemical Society, 2009 - ACS Publications | ... These crystals yielded a structure of 2.2 ? resolution and space group P2 1 2 1 2 1 (PDBid3D6B). Without ... manuscript. We thank Bart Staker for checking the structure of glutaryl-CoA dehydrogenase for PDB deposition. Supporting Information ... |
| 5 | 4ot8 | - | https://pubs.acs.org/doi/abs/10.1021/acschembio.0c00753 | l-Threonine Transaldolase Activity Is Enabled by a Persistent Catalytic Intermediate | 2020 | P Kumar, A Meza, JM Ellis, GA Carlson- ACS Chemical, 2020 - ACS Publications | l-Threonine transaldolases (lTTAs) are a poorly characterized class of pyridoxal-5-phosphate (PLP) dependent enzymes responsible for the biosynthesis of diverse -hydroxy amino acids... The structure was solved by molecular replacement with a distantly related serine hydroxymethyltransferase (PDB ID: 4OT8, 28.2% identity |
| 6 | 4gie | - | https://www.mdpi.com/1422-0067/20/23/5916 | Trypanocidal Mechanism of Action and in silico Studies of p-Coumaric Acid Derivatives | 2019 | SP Lopes, YP Castillo, ML Monteiro- International journal of, 2019 - mdpi.com | In this work, twelve compounds were prepared, maintaining the (E)-3-(4-hydroxyphenyl) acrylic acid structure and modifying only the radical R for 7, C-8, C-9), being six from the aromatic ring and three from the side chain with the presence of carbonyl that confirms the structures |
| 7 | 2lwk | - | https://onlinelibrary.wiley.com/doi/abs/10.1002/advs.202004379 | Light-Driven Cascade Mitochondria-to-Nucleus Photosensitization in Cancer Cell Ablation | 2021 | KN Wang, LY Liu, G Qi, XJ Chao, W Ma, Z Yu- Advanced, 2021 - Wiley Online Library | Herein, a light-driven, mitochondria-to-nucleus cascade dual organelle cancer cell ablation strategy is reported. structure of BT-Ir and DNA structure (5-CAATCGGATCGAATTCGATCCGATTG- 3, PDB code: 5ju4) and RNA structure (5- GAGUAGAAACAAGGCUUCGG CCUGCUUUUGCU-3, PDB code: 2lwk ) using AutoDock 4.2 |
| 8 | 6q04 | - | https://www.sciencedirect.com/science/article/pii/S0079610720301103 | Human coronavirus spike protein-host receptor recognition | 2020 | L Guruprasad- Progress in biophysics and molecular biology, 2020 - Elsevier | cause infection. In this review, we discuss structural features of HCoV spike proteins and recognition of host proteins and carbohydrate receptors. Keywords. Human coronavirus. SARS-CoV. SARS-CoV-2. MERS-CoV. HCoV-HKU1. |
| 9 | 6wps | 7jw0, 7jxe, 7jv2, 7k43, 7jvc | https://www.mdpi.com/965720 | Structural analysis of neutralizing epitopes of the SARS-CoV-2 spike to guide therapy and vaccine design strategies | 2021 | MT Finkelstein, AG Mermelstein, E Parker Miller- Viruses, 2021 - mdpi.com | Multiple structures of S in complex with ACE2 have been determined [9,17,21,22,26 S proteins from SARS-CoV, SARS-CoV-2, and MERS-CoV undergo dramatic structural changes to S2 forms an elongated structure , and the two heptad repeats, HR1 and HR2, eventually form a ... S2M11 from RBM Class III (PDB ID 7K43 [71]), and CR3022 (left) and S309 (right) from RBD Core (PDB IDs 6W41 [86] and PDB ID 6WPS [ |
| 10 | 6xdh | - | https://academic.oup.com/bib/article-abstract/22/2/769/6067883 | SARS-CoV-2 3D database: understanding the coronavirus proteome and evaluating possible drug targets | 2021 | AF Alsulami, SE Thomas, AR Jamasb- Briefings in, 2021 - academic.oup.com | release of the SARS-CoV-2 genome sequence in March 2020, there has been an international focus on developing target-based drug discovery, which also requires knowledge of the 3D structure of the proteome. Where there are no experimentally solved structures , our group ... (v) Nsp15 (Uridylate specific endoribonuclease)—PDB Id: 6XDH. |