We are actively tracking the number of publications by the scientific community which reference our structures, whether in the main text, figure captions or supplementary material. Selected articles are manually reviewed. Publications by SSGCID authors are excluded from the manually reviewed list. From our manual curation results, we estimate that the false positive rate might be as high as 50% for some structures.
This list was obtained from Google Scholar searches using an API provided by Christian Kreibich.
| Structure | Year released | #citations |
|---|---|---|
| 4DZ4 | 2012 | 10 |
| 7JV4 | 2021 | 10 |
| 3K14 | 2009 | 10 |
| 5UPG | 2017 | 10 |
| 3N58 | 2010 | 10 |
| 3EG4 | 2008 | 10 |
| 3JVH | 2009 | 10 |
| 5HA4 | 2016 | 10 |
| 4E98 | 2012 | 9 |
| 3ECD | 2008 | 9 |
| # | PDB | Additional SSGCID structures cited | Link | Title | Year | Citation | Highlighted abstract |
|---|---|---|---|---|---|---|---|
| 1 | 4ot8 | - | https://pubs.acs.org/doi/abs/10.1021/acschembio.0c00753 | l-Threonine Transaldolase Activity Is Enabled by a Persistent Catalytic Intermediate | 2020 | P Kumar, A Meza, JM Ellis, GA Carlson- ACS Chemical, 2020 - ACS Publications | l-Threonine transaldolases (lTTAs) are a poorly characterized class of pyridoxal-5-phosphate (PLP) dependent enzymes responsible for the biosynthesis of diverse -hydroxy amino acids... The structure was solved by molecular replacement with a distantly related serine hydroxymethyltransferase (PDB ID: 4OT8, 28.2% identity |
| 2 | 6xk2 | - | https://www.nature.com/articles/s41467-024-50955-0 | Accurate prediction of protein function using statistics-informed graph networks | 2024 | YJ Jang, QQ Qin, SY Huang, ATJ Peter- Nature, 2024 - nature.com | The scores are mapped to color the MgIA 3D structure ( PDB ID: 6IZW) from lower (blue) to higher (red), GDP is shown with sphere in yellow, SO 4 in stick in cyan, and Mg 2+ ion in a ... The activation scores are mapped to the tertiary structures of nine proteins, including ... Tyrosine-protein kinase BTK (TpK-BTK, PDB ID: 6W8I), Ribokinase (PDB ID: 6XK2), alpha-lactalbumin (αLA, PDB ID: 1HFX) |
| 3 | 3oc6 | 3ico, 3v2i | https://www.mdpi.com/2073-4352/9/11/597 | Carboxylic Ester Hydrolases in Bacteria: Active Site, Structure, Function and Application | 2019 | C Oh, TD Kim, KK Kim- Crystals, 2019 - mdpi.com | In the Protein Data Bank ( PDB ), 136 crystal structures of bacterial CEHs (424 PDB codes) from The // sandwich architecture is most frequently found in CEHs, but 3-solenoid, are widely used in industrial applications, and are the objects of research in structure - or mutation ... 6-phosphogluconolactonases from M. smegmatis (representative PDB code: 3OC6) [140] belonging to group 3-4 CEHs contains His151-Glu149 as a catalytic dyad with nucleophilic water (Figure 3I). |
| 4 | 6q04 | - | https://www.sciencedirect.com/science/article/pii/S0079610720301103 | Human coronavirus spike protein-host receptor recognition | 2020 | L Guruprasad- Progress in biophysics and molecular biology, 2020 - Elsevier | cause infection. In this review, we discuss structural features of HCoV spike proteins and recognition of host proteins and carbohydrate receptors. Keywords. Human coronavirus. SARS-CoV. SARS-CoV-2. MERS-CoV. HCoV-HKU1. |
| 5 | 2lwk | - | https://onlinelibrary.wiley.com/doi/abs/10.1002/advs.202004379 | Light-Driven Cascade Mitochondria-to-Nucleus Photosensitization in Cancer Cell Ablation | 2021 | KN Wang, LY Liu, G Qi, XJ Chao, W Ma, Z Yu- Advanced, 2021 - Wiley Online Library | Herein, a light-driven, mitochondria-to-nucleus cascade dual organelle cancer cell ablation strategy is reported. structure of BT-Ir and DNA structure (5-CAATCGGATCGAATTCGATCCGATTG- 3, PDB code: 5ju4) and RNA structure (5- GAGUAGAAACAAGGCUUCGG CCUGCUUUUGCU-3, PDB code: 2lwk ) using AutoDock 4.2 |
| 6 | 3laa | 3la9 | https://link.springer.com/article/10.1007/s00430-019-00652-3 | Recent advances in the understanding of trimeric autotransporter adhesins | 2019 | AR Kiessling, A Malik, A Goldman- Medical Microbiology and Immunology, 2019 - Springer | ring (Orange) domains. c Top view of Hia BD1( PDB ID:1S7M) rep- resenting tryptophan side chain from each monomer. d Structure of BpaA ( PDB ID: 3LAA ) representing FGG (Violet purple), short neck (Olive), head (Teal), long neck (Blue) domains |
| 7 | 3p0x | - | https://www.nature.com/articles/s41467-019-12614-7 | Acetyl-CoA-mediated activation of Mycobacterium tuberculosis isocitrate lyase 2 | 2019 | RP Bhusal, W Jiao, BXC Kwai, J Reynisson- Nature, 2019 - nature.com | The structural resemblance of the Mtb ICL2 C-terminal domain to members of the GNAT observed in crystal structures of isocitrate-bound ICL1 from Brucella melitensis (Bm ICL1, PDB 3P0X ) of the active site loop are more similar to that found in the crystal structure of substrate |
| 8 | 6wps | 7jw0, 7jxe, 7jv2, 7k43, 7jvc | https://www.mdpi.com/965720 | Structural analysis of neutralizing epitopes of the SARS-CoV-2 spike to guide therapy and vaccine design strategies | 2021 | MT Finkelstein, AG Mermelstein, E Parker Miller- Viruses, 2021 - mdpi.com | Multiple structures of S in complex with ACE2 have been determined [9,17,21,22,26 S proteins from SARS-CoV, SARS-CoV-2, and MERS-CoV undergo dramatic structural changes to S2 forms an elongated structure , and the two heptad repeats, HR1 and HR2, eventually form a ... S2M11 from RBM Class III (PDB ID 7K43 [71]), and CR3022 (left) and S309 (right) from RBD Core (PDB IDs 6W41 [86] and PDB ID 6WPS [ |
| 9 | 5cy4 | - | https://academic.oup.com/nar/article-abstract/48/10/5572/5828917 | Human REXO2 controls short mitochondrial RNAs generated by mtRNA processing and decay machinery to prevent accumulation of double-stranded RNA | 2020 | M Szewczyk, D Malik, LS Borowski- Nucleic acids, 2020 - academic.oup.com | Here, we report comprehensive functional, biochemical, and structural studies to elucidate REXO2 function in human mitochondria We also demonstrate that REXO2 degrades RNA in a structure - and sequence-dependent manner. ... The model that was used for molecular replacement was oligoribonuclease from Acinetobacter baumnii (PDB ID: 5CY4, Seattle Structure Genomics Centre for Infectious Diseases), which shares 48.3% sequence identity with REXO2. |
| 10 | 3f0d | - | https://pubs.acs.org/doi/abs/10.1021/acsomega.0c01337 | Upgraded AMBER Force Field for Zinc-Binding Residues and Ligands for Predicting Structural Properties and Binding Affinities in Zinc-Proteins | 2020 | M Macchiagodena, M Pagliai, C Andreini, A Rosato- ACS, 2020 - ACS Publications | Journal Logo. Upgraded AMBER Force Field for Zinc-Binding Residues and Ligands for Predicting Structural Properties and Binding Affinities in Zinc-Proteins. Marina Macchiagodena Marina Macchiagodena. Dipartimento di |